A DNA Sequence Has Been Cut into the Four Overlapping

question 24

Multiple Choice

A DNA sequence has been cut into the four overlapping sequence fragments below: (1) AGGGGCCTATAGCATACGTACA
(2) CGTACATCTGAGGGTACGATCATGGC
(3) CATGGCTAGCAAACGCGATCCCAAG
(4) AGGCTAGTTACGATATAGGGGCC
What is the correct order of these fragments?

• A) 1;2;3;4
• B) 1;3;2;4
• C) 2;3;1;4
• D) 4;1;2;3
• E) 4;1;3;2

---

Definitions:

Trend Analysis

A method used to analyze and track the movements or directions of data points, such as prices or sales over time, to forecast future trends.

Horizontal Analysis

A financial analysis method that compares historical financial data over a series of periods to identify trends and changes.

Horizontal Analysis

A financial analysis technique that compares line items in financial statements over a series of periods to identify trends.

Income Statement

A financial statement that shows a company's revenues and expenses over a specific period, resulting in net profit or loss.