A DNA Sequence Has Been Cut into the Four Overlapping

question 24

Multiple Choice

A DNA sequence has been cut into the four overlapping sequence fragments below: (1) AGGGGCCTATAGCATACGTACA
(2) CGTACATCTGAGGGTACGATCATGGC
(3) CATGGCTAGCAAACGCGATCCCAAG
(4) AGGCTAGTTACGATATAGGGGCC
What is the correct order of these fragments?

• A) 1;2;3;4
• B) 1;3;2;4
• C) 2;3;1;4
• D) 4;1;2;3
• E) 4;1;3;2

---

Definitions:

Supply and Demand

A fundamental economic model that describes how prices and quantities are determined in a market based on producers' supply and consumers' demand.

Domestic Producer Surplus

The difference between the amount domestic producers are willing to accept for a good or service and the actual amount they receive.

World Price

The world price is the price at which goods are traded internationally, determined by global supply and demand conditions.

Government Payments

Funds distributed by the government to individuals, businesses, or other governmental entities, which can include subsidies, grants, or welfare payments.