Here Are Noncoding Sequences from Mary and Bob

question 5

Multiple Choice

Here are noncoding sequences from Mary and Bob.Both sequences come from the same region of chromosome 12:
Mary: TTCGTTCCCAGCTAGCTAGCTAGCTAGCTTAACCGGC
Bob: TTCGTTCCCAGCTAGCTTAACCGGC
Which of the following accurately compares Mary and Bob's DNA?

• A) Mary and Bob are most likely fraternal twins.
• B) Mary has five STRs at this site;Bob has two.
• C) Mary has one STR at this site;Bob has none.
• D) The DNA shown must be from the 23rd chromosome,not the 12th.
• E) None of the above.

---

Definitions:

Evolutionary Species Concept

A definition of species based on evolutionary lineage, where a species is a lineage of populations which maintains its identity from other such lineages and has its own evolutionary tendencies and historical fate.

Natural Selection

The process by which organisms better adapted to their environment tend to survive and produce more offspring.

Morphologically Different

Having distinct form or structure, especially between groups of organisms or parts of the same organism.

Diverged

Refers to the process where two or more entities become different or develop in different directions, often used in evolutionary biology to describe species.