Here Are Noncoding Sequences from Mary and Bob

question 5

Multiple Choice

Here are noncoding sequences from Mary and Bob.Both sequences come from the same region of chromosome 12:
Mary: TTCGTTCCCAGCTAGCTAGCTAGCTAGCTTAACCGGC
Bob: TTCGTTCCCAGCTAGCTTAACCGGC
Which of the following accurately compares Mary and Bob's DNA?

• A) Mary and Bob are most likely fraternal twins.
• B) Mary has five STRs at this site;Bob has two.
• C) Mary has one STR at this site;Bob has none.
• D) The DNA shown must be from the 23rd chromosome,not the 12th.
• E) None of the above.

---

Definitions:

Long-chain Alkanes

Hydrocarbons that consist of a long sequence of carbon atoms bonded together with hydrogen atoms, used in various fuel and lubricant applications.

Reaction Process

The series of steps that lead to the conversion of reactants into products during a chemical reaction, including all intermediate forms and mechanisms.

Cyclopentane

A cyclic alkane with the formula C5H10, characterized by a ring of five carbon atoms.

Boiling Point

The temperature at which a substance changes from a liquid to a gas.