Using the Following Chart,what Chain of Amino Acids Would Be

question 53

Multiple Choice

Using the following chart,what chain of amino acids would be produced by the sequence of this very short,complete gene: UAUUAUGCCUGAGUGAAUUGCUA?

• A) tyrosine-tyrosine-alanine
• B) tyrosine-tyrosine-alanine-stop-valine-asparagine-cysteine
• C) methionine-proline-glutamate
• D) methionine-proline-glutamate-isoleucine-alanine

---

Definitions:

Hierakonopolis

Hierakonopolis is an ancient Egyptian city, known as one of the earliest urban centers along the Nile, significant for its archaeological importance in understanding early dynastic Egypt.

Thebes

An ancient Egyptian city on the Nile river, historically significant as a religious and political center, famous for its temples and tombs.

Hunting Scenes

Artistic representations of the activity of pursuing and capturing or killing wild animals, often found in historical and prehistorical art.

Tomb Interiors

The inside spaces of tombs, often decorated and containing artifacts and remains of the deceased.