This Sequence Is the 5′ End of a MRNA: 5′

question 29

Multiple Choice

This sequence is the 5′ end of a mRNA: 5′ UUCGACCAUUAACGGUUGAAGGUAG 3′
-If this mRNA is transcribed and translated in the mitochondria, what amino acid sequence is encoded?

• A)Phe Asp His
• B)Met Asn Gly Trp
• C)Met Asn Gly
• D)Translation will not begin.

---

Definitions:

Milgram Experiment

A psychological experiment conducted by Stanley Milgram in the 1960s to study obedience to authority, where participants were instructed to administer electric shocks to another person.

Stanford University Prison Experiment

A psychological study conducted by Philip Zimbardo in 1971 at Stanford University, where students were assigned roles of prisoners and guards to explore the effects of perceived power.

Generalization

Drawing a conclusion about a certain characteristic of a population based on a sample from it.

Logical Support

The provision of reasons or evidence to justify a claim or argument.