Examlex

Solved

You Performed a Sanger Sequencing Reaction and Obtained the Following

question 11

Multiple Choice

You performed a Sanger sequencing reaction and obtained the following read.In this figure, A = green, C = purple, G = black, T = red.The height of the peaks is unimportant.The smallest molecule is at the left of the trace. You performed a Sanger sequencing reaction and obtained the following read.In this figure, A = green, C = purple, G = black, T = red.The height of the peaks is unimportant.The smallest molecule is at the left of the trace.   -What is the sequence of the template DNA used for this sequencing reaction? A) 5' TTTGCTTTGTGAGCGGATAACAA 3' B) 3' TTTGCTTTGTGAGCGGATAACAA 5' C) 5' AAACGAAACACTCGCCTATTGTT 3' D) 3' AAACGAAACACTCGCCTATTGTT 5'
-What is the sequence of the template DNA used for this sequencing reaction?


Definitions:

Unrealized Gain

A profit that exists on paper resulting from an investment that has not yet been sold for cash.

Trading Investments

Trading Investments refer to securities bought and held primarily for selling them in the short term to profit from price fluctuations.

Other Revenue

Revenue from sources other than the primary operating activity of a business.

Subsidiary Company

The corporation that is controlled by a parent company.

Related Questions