In Frogs, Green Skin Is Determined by Gene B

question 14

Multiple Choice

In frogs, green skin is determined by gene B.The wild-type sequence of the 5′ end of the RNA-like strand of the entire first exon is shown below.The gene encodes an enzyme that functions to convert a brown compound into a green pigment in the skin.
5′ ACTCAAGCACAGGTCGCATAAATGTTCCTGTTATTTGG… 3′
The table of codons is provided here:
-Which are the first three amino acids encoded by the wild-type sequence of gene B?

• A)N-Thr-Gln-Ala…
• B)N-Pro-Asn-Asn…
• C)N-Met-Phe-Leu…
• D)N-Ser-Ser-Val…
• E)The correct sequence is not shown here.

---

Definitions:

Environmental Movement

A diverse scientific, social, and political movement for addressing environmental issues through advocacy, education, and policy changes.

Greenhouse Effect

The trapping of the sun's warmth in the planet's lower atmosphere due to the greater transparency of the atmosphere to visible radiation from the sun than to infrared radiation emitted from the planet's surface.

Carbon Dioxide

A colorless, odorless gas produced by burning carbon and organic compounds and by respiration. It is naturally present in air and is absorbed by plants in photosynthesis.

Environmental Threats

Challenges or hazards to the environment and human health, including pollution, climate change, and biodiversity loss.