HindIII Is a Restriction Enzyme That Cuts the DNA Sequence

question 29

Multiple Choice

HindIII is a restriction enzyme that cuts the DNA sequence AAGCTT between the two A bases. How many times would HindIII cut the following DNA molecule? GTAAGCTTCGACAAGCTTGCTGA

• A)0 times
• B)1 time
• C)2 times
• D)3 times

---

Definitions:

Rituals

Established procedures or ceremonies that are followed regularly, often having symbolic significance in organizations or cultures.

Corporate Culture

The shared values, beliefs, and practices that characterize an organization and influence its employees' behavior.

Bond Together

This refers to the creation of a connection or a stronger relationship among individuals or groups, often aimed at achieving mutual goals or facing common challenges.

Organizational Stories

Narratives told within an organization that communicate culture, values, and lessons, often based on real events or exemplary figures.