HindIII Is a Restriction Enzyme That Cuts the DNA Sequence

question 29

Multiple Choice

HindIII is a restriction enzyme that cuts the DNA sequence AAGCTT between the two A bases. How many times would HindIII cut the following DNA molecule? GTAAGCTTCGACAAGCTTGCTGA

• A)0 times
• B)1 time
• C)2 times
• D)3 times

---

Definitions:

Organic Product

A substance that originates from living entities or is produced through organic processes.

Reaction

A process in which substances, the reactants, transform into different substances, the products, through a chemical change.

Reaction

A process in which substances, the reactants, undergo chemical changes to form new substances, known as products.

Product

The substances that result from the completion of a chemical reaction.