Examlex

Solved

You Are Working on an Insulin-Binding Protein from Fish

question 15

Short Answer

You are working on an insulin-binding protein from fish. The beginning of the coding sequence of the gene is shown below. You find a mutant in the gene that cannot bind insulin (also shown below-the mutation is set in boldface type). Among a population of fish having the gene for the mutant protein, you find one that produces a variant of this protein that can now bind insulin again (DNA sequence also shown below). What kind of mutation is this new variant? (Use a genetic rather than a biochemical classification.) Original sequence: atgtgtcctatgtgagttgcggcttgttg
Mutant sequence: atg g tgtcctatgtgagttgcggctgttg
Variant sequence: atg g tgtcctatgtgagttgcggcttg g tg


Definitions:

Stakeholder Ethics

Principles and guidelines that govern the interactions and responsibilities of individuals or organizations towards those who have an interest or stake in a project, outcome, or business.

Johnson & Johnson

Johnson & Johnson is a multinational corporation founded in 1886 that develops medical devices, pharmaceutical, and consumer packaged goods.

Employees

Individuals who work for someone else or for a company in exchange for compensation.

Citizenship Efforts

Activities undertaken by individuals that go beyond their basic job requirements to contribute positively to the organization's environment.

Related Questions