Examlex
You are working on an insulin-binding protein from fish. The beginning of the coding sequence of the gene is shown below. You find a mutant in the gene that cannot bind insulin (also shown below-the mutation is set in boldface type). Among a population of fish having the gene for the mutant protein, you find one that produces a variant of this protein that can now bind insulin again (DNA sequence also shown below). What kind of mutation is this new variant? (Use a genetic rather than a biochemical classification.) Original sequence: atgtgtcctatgtgagttgcggcttgttg
Mutant sequence: atg g tgtcctatgtgagttgcggctgttg
Variant sequence: atg g tgtcctatgtgagttgcggcttg g tg
Appetite
A psychological desire for food, which can be influenced by sensory experiences, emotions, and environmental factors.
Fat Conversion
The biochemical process of transforming fats into energy or other substances within the body.
Insulin Levels
Refer to the concentration of insulin in the bloodstream, which is crucial for regulating blood glucose levels.
Increased Appetite
A heightened desire to consume food, which can be influenced by physical, emotional, or psychological factors.
Q3: A scientist is studying a gene known
Q15: What do you expect would develop if
Q37: Which of the following are errors in
Q51: Which one of the following statements regarding
Q55: Which of the following statements accurately describes
Q56: Which of the following statements about response
Q65: What results would indicate the scientist should
Q71: Which of the following DNA sequences are
Q72: Both strands of a DNA molecule are
Q80: You and a close friend from the