Examlex

Solved

You Are Working on an Insulin-Binding Protein from Fish

question 15

Short Answer

You are working on an insulin-binding protein from fish. The beginning of the coding sequence of the gene is shown below. You find a mutant in the gene that cannot bind insulin (also shown below-the mutation is set in boldface type). Among a population of fish having the gene for the mutant protein, you find one that produces a variant of this protein that can now bind insulin again (DNA sequence also shown below). What kind of mutation is this new variant? (Use a genetic rather than a biochemical classification.) Original sequence: atgtgtcctatgtgagttgcggcttgttg
Mutant sequence: atg g tgtcctatgtgagttgcggctgttg
Variant sequence: atg g tgtcctatgtgagttgcggcttg g tg


Definitions:

Appetite

A psychological desire for food, which can be influenced by sensory experiences, emotions, and environmental factors.

Fat Conversion

The biochemical process of transforming fats into energy or other substances within the body.

Insulin Levels

Refer to the concentration of insulin in the bloodstream, which is crucial for regulating blood glucose levels.

Increased Appetite

A heightened desire to consume food, which can be influenced by physical, emotional, or psychological factors.

Related Questions