You Are Working on an Insulin-Binding Protein from Fish

question 15

Short Answer

You are working on an insulin-binding protein from fish. The beginning of the coding sequence of the gene is shown below. You find a mutant in the gene that cannot bind insulin (also shown below-the mutation is set in boldface type). Among a population of fish having the gene for the mutant protein, you find one that produces a variant of this protein that can now bind insulin again (DNA sequence also shown below). What kind of mutation is this new variant? (Use a genetic rather than a biochemical classification.) Original sequence: atgtgtcctatgtgagttgcggcttgttg
Mutant sequence: atg g tgtcctatgtgagttgcggctgttg
Variant sequence: atg g tgtcctatgtgagttgcggcttg g tg

---

Definitions:

Paid-in Capital

The sum of funds a business has obtained from its stockholders by selling them stock shares.

Par Value

A nominal value assigned to a share of stock in the charter of a corporation, which does not necessarily reflect its market value.

Common Stock

Equity securities representing ownership in a corporation, providing voting rights, and a dividend claim on earnings.

Cumulative Nonparticipating Preferred Stock

Preferred stock that accumulates unpaid dividends, which must be paid out before dividends can be distributed to common stockholders, but does not participate beyond the fixed dividend.