The Sequence Below Represents a Pre-MRNA

question 29

Multiple Choice

The sequence below represents a pre-mRNA. What would happen if the G in the 5ʹ splice site were mutated to a C? mRNA: 5'ACUGGACAGGUAAGAAUACAACACAGUCGGCACCACG 3'

• A) The U2 snRNA would not be able to bind to the branch point because it could not recognize it.
• B) The spliceosome complex would be degraded because it could no longer recognize the 5ʹ splice site.
• C) The U1 snRNA would not be able to bind complementarily to the 5ʹ splice site.
• D) Splicing would still occur appropriately because the G is not essential at the 5ʹ splice site.
• E) The 5ʹ cap would not be able to be added because it requires the 5ʹ splice site to be functional.

---

Definitions:

Vertical Equity

Refers to the principle that individuals who are more capable of paying taxes should contribute more to the tax system, ensuring a fairer distribution based on ability to pay.

Tax System

The structured method by which a government or authority levies taxes on individuals, businesses, and transactions.

U.S. Economy

The economic system of the United States, characterized by a mixture of private and public enterprise and known for being one of the world’s largest and most complex economies.

Income

The financial gain received by an individual or entity, typically through wages, profits, rents, or investments.