Use the Pre-MRNA Sequence Shown Below to Answer the Following

question 71

Essay

Use the pre-mRNA sequence shown below to answer the following questions.
mRNA: 5'ACUGGACAGGUAAGAAUACAACACAGUCGGCACCACG 3'
a. Underline the 5' and 3' splice sites, then write the sequence of the spliced mRNA in the space provided.
b. Predict what would happen if the G in the 5' splice site were mutated to a C.
c. We learned in this chapter that the 5' cap in an mRNA plays a role in translation initiation. What do you think is one plausible mechanism by which a 5' cap can enhance initiation? How can you experimentally demonstrate that a 5' cap is important for this process?

---

Definitions:

Communicate Value

Effective presentation of a product's or service's benefits to potential customers to highlight why it is worth purchasing.

Personal Trainers

Certified professionals who guide individuals in exercises and fitness routines tailored to their health and fitness goals.

Free Personal Training

Complimentary coaching services offered, typically by gyms or fitness centers, to help individuals achieve their personal health and fitness goals.

Supply Chain

refers to the network of all the individuals, organizations, resources, activities, and technology involved in the creation and sale of a product, from the delivery of source materials from the supplier to the manufacturer, and eventually to the end user.