The Sequence Below Represents a Pre-MRNA

question 29

Multiple Choice

The sequence below represents a pre-mRNA. What would happen if the G in the 5ʹ splice site were mutated to a C? mRNA: 5'ACUGGACAGGUAAGAAUACAACACAGUCGGCACCACG 3'

• A) The U2 snRNA would not be able to bind to the branch point because it could not recognize it.
• B) The spliceosome complex would be degraded because it could no longer recognize the 5ʹ splice site.
• C) The U1 snRNA would not be able to bind complementarily to the 5ʹ splice site.
• D) Splicing would still occur appropriately because the G is not essential at the 5ʹ splice site.
• E) The 5ʹ cap would not be able to be added because it requires the 5ʹ splice site to be functional.

---

Definitions:

Organizational Strategies

Comprehensive plans and actions implemented by businesses or organizations to achieve long-term goals and objectives.

Managing Stress

involves strategies and techniques to control and reduce stress levels in oneself or in the workplace to improve well-being and performance.

Common Health Problem

A frequently occurring illness or health issue within a population.

Depression

A mental health disorder characterized by persistently low mood, a lack of interest in activities, and various other symptoms that interfere with daily life.