In the Following DNA Molecule, How Many 3´ Hydoxyls Are

question 32

Multiple Choice

In the following DNA molecule, how many 3´ hydoxyls are present? AATAGCGGATGCCCGAATACGAG
TTATCGCCTACGGGCTTATGCTC

• A) 4
• B) 2
• C) 0
• D) 24

---

Definitions:

Hemoglobin

Hemoglobin is a protein in red blood cells that carries oxygen from the lungs to the body's tissues and returns carbon dioxide from the tissues back to the lungs.

Secondary Structure

The local folded structures that form within a polypeptide due to interactions between atoms in the backbone, typically alpha-helices and beta-sheets.

Quaternary Structure

The level of protein structure involving the arrangement and interaction of multiple polypeptide chains.

Disulfide Linkages

Chemical bonds formed between sulfur atoms of two amino acid residues, playing a critical role in the three-dimensional structure of proteins.