In the Following DNA Molecule, How Many Hydrogen Bonds Are

question 75

Multiple Choice

In the following DNA molecule, how many hydrogen bonds are present? AATAGCGGATGCCCGAATACGAG
TTATCGCCTACGGGCTTATGCTC

• A) 24
• B) 48
• C) 58
• D) 0
• E) 3

---

Definitions:

Secondary Palate

The part of the palate that separates the nasal cavities from the oral cavity in mammals, contributing to the ability to eat and breathe simultaneously.

Mandibular Processes

Refers to the extensions or projections of the mandible bone, which contribute to jaw formation and are critical in chewing and speech.

Foramen Ovale

In the fetal heart, the oval opening in the septum secundum; the persistent part of septum primum acts as a valve for this interatrial communication during fetal life; postnatally, the septum primum becomes fused to the septum secundum to close the foramen ovale, forming the fossa ovale.

Septum Primum

First septum in the embryonic heart that arises on the wall of the originally single atrium of the heart and separates it into right and left chambers.