In the Following DNA Molecule, How Many Ribose Sugars Are

question 64

Multiple Choice

In the following DNA molecule, how many ribose sugars are present? AATAGCGGATGCCCGAATACGAG
TTATCGCCTACGGGCTTATGCTC

• A) 48
• B) 24
• C) 4
• D) 2
• E) 0

---

Definitions:

Salvage Value

The anticipated salvage value of an asset at the termination of its service life.

Annual Cash Flows

The total amount of money being transferred into and out of a business, especially affecting liquidity, within a year.

Opportunity Cost

The cost of opting for one choice over another, essentially the benefits you could have received by taking an alternative action.

Internal Rate Of Return

The internal rate of return is a financial metric used to evaluate the profitability of investments, calculating the discount rate that makes the net present value of cash flows from an investment equal to zero.