How Many Polypeptides Are Coded for by the Following MRNA

question 17

Multiple Choice

How many polypeptides are coded for by the following mRNA: 5'GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGACCAGGUCAA3'

• A) 7
• B) 8
• C) 10
• D) 13

---

Definitions:

Frequency

Number of repetitions of a process or series of events within a specific time frame.

Multiplexing

A technique in telecommunications and signal processing where multiple signals or information streams are combined into one signal over a shared medium.

Truck Electronics

The electronic systems and devices integrated into trucks, managing functions such as engine control, navigation, and communication.

Piezo-Resistive

Pertaining to a material or device that changes its electrical resistance in response to mechanical stress.