Examlex

Solved

GGGCCATTCGAACGTCCGAAAATGCCCCTGAATGAAAATTTTGGCCC

question 30

Multiple Choice

GGGCCATTCGAACGTCCGAAAATGCCCCTGAATGAAAATTTTGGCCC. The primer used for replication in vitro is CCCGGTAAGCTT. Where is the 5' end for the template and primer, respectively?


Definitions:

Cytokines

Small proteins released by cells that affect the behavior of other cells, playing a crucial role in immune responses and inflammation.

Immune Response

A complex biological reaction of the body against pathogens, such as bacteria and viruses, involving specialized cells and antibodies to protect against infection and disease.

Pre-T Cells

Immature T cells that are in the process of developing their specificity and functionality in the thymus.

Pre-B Cells

Immature B cells undergoing maturation in the bone marrow, important for the adaptive immune system.

Related Questions