Four Unique Sequences Have Been Amplified Using PCR of the SSU

question 21

Essay

Four unique sequences have been amplified using PCR of the SSU rRNA gene from four unknown microorganisms. Calculate the percent relatedness of each in comparison with the known sequence given to determine which strains are most phylogenetically related. What would a molecular, rectangular phylogenetic tree of divergence of the four sequences look like?
(1) AAATGTTGGGCTTCCGGCAGTAGTGAGTG
(2) AAATGTTGGGATTCCGGAAGTAGTGAGTG
(3) AAATGCTGGGCTTCCGGAAGTAGCGAGTG
(4) AAATGATGGGCTTCCGGGAGCGAGTGCCC

---

Definitions:

Biological Drive

Innate impulses in living organisms that motivate behavior necessary for the survival of the individual and the species, such as hunger, thirst, and reproduction.

Social Needs

Fundamental human requirements for belonging, love, and affection from social groups and relationships.

Physiological Needs

Basic physical requirements essential to human survival, such as air, water, food, shelter, and sleep, posited by Maslow as the foundation of his hierarchy of needs.

Modern Conveniences

Technologies, devices, or services that simplify tasks and make daily life easier compared to past times.