Four Unique Sequences Have Been Amplified Using PCR of the SSU

question 21

Essay

Four unique sequences have been amplified using PCR of the SSU rRNA gene from four unknown microorganisms. Calculate the percent relatedness of each in comparison with the known sequence given to determine which strains are most phylogenetically related. What would a molecular, rectangular phylogenetic tree of divergence of the four sequences look like?
(1) AAATGTTGGGCTTCCGGCAGTAGTGAGTG
(2) AAATGTTGGGATTCCGGAAGTAGTGAGTG
(3) AAATGCTGGGCTTCCGGAAGTAGCGAGTG
(4) AAATGATGGGCTTCCGGGAGCGAGTGCCC

---

Definitions:

Psychosexual Development

A theory introduced by Sigmund Freud that describes how personality develops during childhood through a series of stages centered on erogenous zones.

Fixation

In psychoanalytic theory, leaving a disproportionate share of one’s libido behind at an earlier stage of development.

Libido

A term in psychoanalytic theory for the energy of the sexual drive as a component of the life instinct.

Genital Stage

In psychoanalytic theory, the final stage of psychosexual development, in which the physical focus of the libido is on the genitals, with an emphasis on heterosexual relationships. The stage begins at about puberty, but is only fully attained when and if the individual achieves psychological maturity.