HindIII Is a Restriction Enzyme That Cuts the DNA Sequence

question 29

Multiple Choice

HindIII is a restriction enzyme that cuts the DNA sequence AAGCTT between the two A bases. How many times would HindIII cut the following DNA molecule? GTAAGCTTCGACAAGCTTGCTGA

• A)0 times
• B)1 time
• C)2 times
• D)3 times

---

Definitions:

Phantom Limb Sensations

refer to the perception of sensations, often pain, in a limb that has been amputated, indicating brain and nerve involvement.

Sensory Input

Information received by the senses such as sight, sound, touch, taste, and smell, that is then interpreted by the brain.

Peak Moment

The highest or most intense point in the development or resolution of something.

Physical Pain

An uncomfortable sensory and emotional experience associated with actual or potential tissue damage.