The Sequence of a Region of DNA Around the 5

question 28

Short Answer

The sequence of a region of DNA around the 5? end of a gene in Escherichia coli is shown below. The -10 hexamer and the transcription start site are highlighted. What would be the sequence of the first 10 nucleotides of the mRNA transcribed from this gene? Write down the sequence from 5? to 3?, e.g. CGGAUAAACT.
5?…GCGCTTGGTATAATCGCTGGGGGTCAAAGAT…3?

---

Definitions:

Lateral Malleolus

The bony prominence on the outer side of the ankle, forming the lower end of the fibula.

Ulnar Notch

A depression on the distal end of the radius bone that articulates with the head of the ulna, allowing wrist movement.

Medial Epicondyle

The bony projection on the inner side of the humerus just above the elbow joint, where certain ligaments and tendons of the forearm attach.

Greater Tubercle

A prominent area on the lateral aspect of the proximal humerus, serving as an attachment site for the muscles of the shoulder.