Examlex

Solved

The Sequence of a Region of DNA Around the 5

question 28

Short Answer

The sequence of a region of DNA around the 5? end of a gene in Escherichia coli is shown below. The -10 hexamer and the transcription start site are highlighted. What would be the sequence of the first 10 nucleotides of the mRNA transcribed from this gene? Write down the sequence from 5? to 3?, e.g. CGGAUAAACT.
5?…GCGCTTGGTATAATCGCTGGGGGTCAAAGAT…3?


Definitions:

Physiological Arousal

The body's response to external stimuli, resulting in physical and psychological reactions such as increased heart rate or heightened alertness.

Catharsis

The process of releasing, and thereby providing relief from, strong or repressed emotions, often through art, drama, or psychological means.

Handling Anger

Methods or strategies used by individuals to manage and express anger in a healthy and constructive manner.

Reacting Assertively

Engaging in clear, honest, and non-aggressive communication of one's rights, feelings, or needs without violating the rights of others.

Related Questions