Examlex
The restriction enzyme SmaI cuts DNA between the last C and the first G in the sequence CCCGGG. What sequences of DNA would be produced if the following sequence were treated with SmaI?
AGTTTCGAGAGCGGATGCCCGGGCCACGGGGATTATACGCAGAGTCCAC
TCAAAGCTCTCGCCTACGGGCCCGGTGCCCCTAATATGCGTCTCAGGTG
Miracle
An extraordinary and welcome event that is not explicable by natural or scientific laws and is therefore attributed to a divine agency.
Symbolic Form
The representation of logical statements using symbols to encapsulate complex ideas succinctly.
Should Do
Prescriptive advice suggesting an action deemed appropriate or beneficial under certain circumstances.
Symbolic Form
The representation of logical expressions through symbols rather than words, aiming for clarity and precision.
Q1: If a molecule of mRNA is a
Q7: A drug inhibits the formation of microtubules.
Q17: Evolution can be described as<br>A) predesigned change
Q22: As the _ separate during prophase, they
Q31: Evolutionary changes on a small scale are
Q33: The process of inhalation requires more energy
Q37: Dinosaurs lived on Pangaea
Q54: In many cases of _ selection, mates
Q67: Electrons gain energy as they move through
Q76: The spindle microtubules break down and new