Referring to the Given Image, What Is the Amino Acid

question 77

Multiple Choice

 
Referring to the given image, what is the amino acid sequence that is coded for by the DNA sequence GATGGACTTGAAGAGTGGTAA?

• A) asp-gly-val-glu-glu-trp-tyr
• B) leu-pro-glu-leu-leu-thr-ile
• C) ile-thr-leu-leu-gly-pro-leu
• D) ser-arg-arg-met-gly-val-stop
• E) met-gly-val-lys-ser-gly-stop

---

Definitions:

Inner Workings

The internal mechanisms or operations that drive an entity, system, or person, often hidden or not immediately apparent.

Social Work

A professional field focused on helping individuals, families, and communities to enhance their well-being and cope with their problems.

Environment

The surrounding conditions, influences, or forces which affect the growth, development, or existence of living beings or the operation of organizations.

Human Services Programs

Initiatives or services designed to meet human needs, focusing on preventing and solving problems as well as enhancing the quality of life for individuals.