Examlex
Based on the gene and protein sequences that follow,what type of mutation has occurred and what is its effect on the polypeptide?
Normal gene: ATGGCCGGCCCGAAAGAGACC
Mutated gene: ATGGCCGGCACCGAAAGAGACC
Normal protein: Met-Ala-Gly-Pro-Lys-Glu-Thr
Mutated protein: Met-Ala-Gly-Thr-Glu-Arg-Asp
Partial Report Method
A research technique used in cognitive psychology to study the capacity and duration of short-term visual memory.
Sperling's Study
A series of experiments by George Sperling that investigated the capacity and duration of the sensory memory.
Sensory Memory
The shortest-term element of memory, which stores impressions of sensory information after the original stimuli have ended, lasting for a very brief period.
Iconic Memory
A type of visual sensory memory that holds an exact copy of what is seen for a very brief period of time, usually under a second.
Q3: Signals can be sent from the ECM
Q3: MicroRNAs (miRNAs)<br>A)are long RNA molecules.<br>B)silence the expression
Q6: The primary advantage C4 plants have over
Q13: Which situation would be most likely to
Q15: Both ATP and NADPH are required for<br>A)electron
Q33: The pressure required to stop water from
Q34: You inject a dye into a cell
Q35: The figure below represents a lineage of
Q44: You are mapping the location of two
Q50: Some bacteria have been found to have