-The Amino Acid Sequence Gly-His-Arg-Lys-Pro-Pro-Ala Is Made from What Codon

question 20

Multiple Choice

$\begin{array}{l}\text { TABLE 14.2 Nucleotide Code for Selected Amino Acids }\\\begin{array}{|lc|}\hline \text { Amino Acid } \quad\quad\quad\quad\quad\quad\quad\quad& \text { Nucleotide Sequence } \\\hline \text { Alanine (Ala) } & \text { GCC } \\\text { Arginine (Arg) } & \text { CGC } \\\text { Asparagine (Asn) } & \text { AAC } \\\text { Aspartate (Asp) } & \text { GAC } \\\text { Glutamine (Gln) } & \text { CAA } \\\text { Glutamate (Glu) } & \text { GAA } \\\text { Glycine (Gly) } & \text { GGC } \\\text { Histidine (His) } & \text { CAC } \\\text { Lysine (Lys) } & \text { AAA } \\\text { Proline (Pro) } & \text { CCC } \\\text { Threonine (Thr) } & \text { ACC } \\\hline\end{array}\end{array}$
-The amino acid sequence Gly-His-Arg-Lys-Pro-Pro-Ala is made from what codon sequence?

• A)GGCCACCGCTTTCCCCCCGCC
• B)CGCCACCGCAAACCCCCCGCC
• C)GGCCACCGCAAACCCCCCGCC
• D)GGCCACCGCAAACCCCCCGCG

---

Definitions:

Ventral Frontal Cortex

A part of the frontal lobe in the brain associated with decision making, risk-taking, and regulating emotions.

Clinical Neuroscience

Specialty in the field of neuroscience that focuses on the diagnosis and treatment of diseases and disorders affecting the brain and central nervous system.

Brain Disorders

A wide range of conditions affecting the brain, leading to physical and psychological symptoms that can impact an individual's ability to function.