-The Amino Acid Sequence Gly-His-Arg-Lys-Pro-Pro-Ala Is Made from What Codon

question 20

Multiple Choice

$\begin{array}{l}\text { TABLE 14.2 Nucleotide Code for Selected Amino Acids }\\\begin{array}{|lc|}\hline \text { Amino Acid } \quad\quad\quad\quad\quad\quad\quad\quad& \text { Nucleotide Sequence } \\\hline \text { Alanine (Ala) } & \text { GCC } \\\text { Arginine (Arg) } & \text { CGC } \\\text { Asparagine (Asn) } & \text { AAC } \\\text { Aspartate (Asp) } & \text { GAC } \\\text { Glutamine (Gln) } & \text { CAA } \\\text { Glutamate (Glu) } & \text { GAA } \\\text { Glycine (Gly) } & \text { GGC } \\\text { Histidine (His) } & \text { CAC } \\\text { Lysine (Lys) } & \text { AAA } \\\text { Proline (Pro) } & \text { CCC } \\\text { Threonine (Thr) } & \text { ACC } \\\hline\end{array}\end{array}$
-The amino acid sequence Gly-His-Arg-Lys-Pro-Pro-Ala is made from what codon sequence?

• A)GGCCACCGCTTTCCCCCCGCC
• B)CGCCACCGCAAACCCCCCGCC
• C)GGCCACCGCAAACCCCCCGCC
• D)GGCCACCGCAAACCCCCCGCG

---

Definitions:

Self-fulfilling Prophecy

A belief or expectation that an individual holds that causes it to become true simply because the belief influences behavior towards that outcome.

Social Processes

The patterns of interactions and changes in relationships and societal norms over time.

Patriarchal Society

A social system in which men hold primary power and predominate in roles of political leadership, moral authority, social privilege, and control of property.

Implications

The possible effects or results of an action or decision, especially those that are unintended or indirect.