Four Unique Sequences Have Been Amplified Using PCR of the SSU

question 21

Essay

Four unique sequences have been amplified using PCR of the SSU rRNA gene from four unknown microorganisms. Calculate the percent relatedness of each in comparison with the known sequence given to determine which strains are most phylogenetically related. What would a molecular, rectangular phylogenetic tree of divergence of the four sequences look like?
(1) AAATGTTGGGCTTCCGGCAGTAGTGAGTG
(2) AAATGTTGGGATTCCGGAAGTAGTGAGTG
(3) AAATGCTGGGCTTCCGGAAGTAGCGAGTG
(4) AAATGATGGGCTTCCGGGAGCGAGTGCCC

---

Definitions:

Human Potential

The inherent capability of individuals to grow, develop, and achieve success through personal improvement and self-actualization.

Good Leader

An individual who possesses the ability to inspire and guide others towards achieving a common goal while demonstrating integrity, vision, and empathy.

Relationship Behavior

Actions and interactions an individual engages in with others, influencing the nature and dynamics of interpersonal relationships.

Duties And Responsibilities

Tasks or actions that are required to be completed as part of one's role or job.