Which Mature Messenger RNA Strand Correctly Reflects the Accurate Transcription

question 16

Multiple Choice

Which mature messenger RNA strand correctly reflects the accurate transcription of the following segment of DNA, in which large letters represent introns and small letters represent exons? tTGCGaAccaGaCTtaaAAtTAAA

• A)AUGGUUAUUA
• B)ACGCTCGATTATTT
• C)CGCUCGAUUAUUU
• D)AACGCUUGGUCUGAAUUUUAAUUU

---

Definitions:

Organizational Strength

The capacity of an organization to utilize its resources effectively to achieve its objectives.

Secondary Category

A further division within a primary classification, used to organize and group items or information more specifically.

Sexual Orientation

Sexual orientation is an enduring pattern of emotional, romantic, or sexual attractions to men, women, both sexes, neither sex, or another sex. It also refers to a person's sense of identity based on those attractions, related behaviors, and membership in a community of others who share those attractions.

Primary Category

A primary category is the main or leading group or classification within a broader system or framework.