The Restriction Enzyme SacI Has a Recognition Sequence of GAGCT^C

question 36

Multiple Choice

The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^) indicates the cut site. Examine the DNA molecule below. AGAGCTCAGTCGAGAGCTCAGATCGATAGGAGCTCAGATCTCGATCACCTC TCTCGAGTCAGCTCTCGAGTCTAGCTATCCTCGAGTCTAGAGCTAGTGGAG
How many separate molecules of DNA would you end up with if you treated the above DNA molecule with SacI?

• A) two
• B) three
• C) four
• D) five

---

Definitions:

Voice Recognition

Technology that can identify and interpret human speech, allowing interaction with devices or systems through spoken commands.

Virtual Assistant

An artificial intelligence program that can perform tasks or services for an individual based on commands or questions.

Desktop Computers

Personal computers designed for regular use at a single location on or near a desk or table due to their size and power requirements.

Notebook Computers

Portable computers that can be easily transported and used in various locations.