Using the following chart,what chain of amino acids would be produced by the sequence of this very short,complete gene: UAUUAUGCCUGAGUGAAUUGCUA? 
Definitions:
Digital Signature
An electronic form of a signature that can securely associate a signer with a document in a recorded transaction.
Signature Line
In documents, a designated line where an individual is expected to sign, indicating approval, consent, or agreement to conditions or terms mentioned.
Hyperlink
A clickable reference or navigation element in a document or web page that leads to another section of the document or another web page.
Digital Signature
A mathematical scheme for demonstrating the authenticity of digital messages or documents.
Q1: As shown in the figure below,the number
Q1: During translation,<br>A) many mRNA molecules work with
Q7: An allele is<br>A) a version of a
Q15: What is the sequence of the codon
Q53: The Cambrian explosion<br>A) caused a lack of
Q56: A disease caused by an inherited mutation
Q58: rough endoplasmic reticulum<br>A)photosynthesis<br>B)regulate what moves in and
Q70: In humans,the herbicide atrazine helps RNA polymerase
Q71: A stop codon is reached.<br>A)first<br>B)second<br>C)third<br>D)fourth<br>E)fifth
Q97: A human gene put into a plant