Using the Following Chart,which Chain of Amino Acids Would Be

question 50

Multiple Choice

Using the following chart,which chain of amino acids would be produced by the sequence of this very short,complete mRNA: UAUUAUGCCUGAGUGAAUUGCUA?

• A) tyrosine-tyrosine-alanine
• B) tyrosine-tyrosine-alanine-stop-valine-asparagine-cysteine
• C) methionine-proline-glutamate
• D) methionine-proline-glutamate-isoleucine-alanine

---

Definitions:

Opiates

A group of drugs derived from opium used for their analgesic, narcotic, and sedative properties.

Barbiturates

A class of drugs that act as central nervous system depressants, used to treat anxiety, insomnia, and seizure disorders.

Overdose

An overdose occurs when a person consumes an excessive amount of a substance, typically a drug, leading to potentially serious or lethal side effects.

Blood Pressure

The force exerted by circulating blood on the walls of blood vessels, essential for transporting oxygen and nutrients throughout the body.