Using the Following Chart,which Chain of Amino Acids Would Be

question 50

Multiple Choice

Using the following chart,which chain of amino acids would be produced by the sequence of this very short,complete mRNA: UAUUAUGCCUGAGUGAAUUGCUA?

• A) tyrosine-tyrosine-alanine
• B) tyrosine-tyrosine-alanine-stop-valine-asparagine-cysteine
• C) methionine-proline-glutamate
• D) methionine-proline-glutamate-isoleucine-alanine

---

Definitions:

Informed and Curious

A state of being knowledgeable on a subject while maintaining a desire to learn more and understand deeper.

Immigration Waves

Periods when large numbers of people migrate from one country to another, which can have significant cultural, economic, and social effects on the sending and receiving countries.

Dominant Culture

The prevailing cultural norms, values, and practices of the majority group within a society that influence its social institutions and power structures.

Presenting Problems

are the initial concerns or issues brought forth by an individual seeking help or therapy.