The Restriction Enzyme SmaI Cuts DNA Between the Last C

question 28

Multiple Choice

The restriction enzyme SmaI cuts DNA between the last C and the first G in the sequence CCCGGG.How many fragments of DNA would be produced if the following sequence were treated with SmaI? AGTTTCGAGAGCGGATGCCCGGGCCACGGGGATTATACGCAGAGTCCAC
TCAAAGCTCTCGCCTACGGGCCCGGTGCCCCTAATATGCGTCTCAGGTG

• A) One; SmaI does not cut this piece of DNA.
• B) Two; SmaI cuts this piece of DNA once.
• C) Two; SmaI cuts this piece of DNA twice.
• D) Four; SmaI cuts this piece of DNA four times.

---

Definitions:

Range Finder

A device or tool used to measure the distance from the observer to a target, commonly used in photography, golf, and surveying.

Cell References

Indicators that point to specific cells in a spreadsheet, used for calculations or to display their contents.

Formula

A mathematical or logical expression entered into a spreadsheet or software that performs calculations based on specified inputs or data.

Format Cells Dialog Box Launcher

A tool in spreadsheet software that opens a dialog box for adjusting the presentation of cell contents, including their format, style, and appearance.