The Restriction Enzyme SmaI Cuts DNA Between the Last C

question 28

Multiple Choice

The restriction enzyme SmaI cuts DNA between the last C and the first G in the sequence CCCGGG.How many fragments of DNA would be produced if the following sequence were treated with SmaI? AGTTTCGAGAGCGGATGCCCGGGCCACGGGGATTATACGCAGAGTCCAC
TCAAAGCTCTCGCCTACGGGCCCGGTGCCCCTAATATGCGTCTCAGGTG

• A) One; SmaI does not cut this piece of DNA.
• B) Two; SmaI cuts this piece of DNA once.
• C) Two; SmaI cuts this piece of DNA twice.
• D) Four; SmaI cuts this piece of DNA four times.

---

Definitions:

Paid Maternity Leave

Employment benefit that provides pay to women during a period of absence from work in the weeks before and after childbirth.

Breast-Feeding

The feeding of babies and young children with milk directly from female human breasts rather than from a baby bottle or other container.

Motor Development

The progression of muscle coordination, strength, and movement patterns, often in infants and young children.

Maturation And Practice

The process of development through natural growth and learning through repeated experiences or exercises.