How Many Amino Acids Are Encoded by the Following MRNA

question 43

Multiple Choice

How many amino acids are encoded by the following mRNA? 5′GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGA3′

• A) 8
• B) 9
• C) 10
• D) 11

---

Definitions:

Police Officers

Law enforcement professionals responsible for maintaining public order, enforcing laws, and preventing, detecting, and investigating crimes.

Body-Worn Cameras

Portable recording devices worn on the body by law enforcement officers to capture interactions with the public and gather evidence.

Major U.S. Cities

Significant urban centers in the United States, characterized by large populations, economic influence, and cultural prominence.

Department of Justice

is a federal executive department of the U.S. government responsible for the enforcement of law and administration of justice, overseen by the Attorney General.