Examlex

Solved

How Many Amino Acids Would Be Included in the Polypeptide

question 32

Multiple Choice

How many amino acids would be included in the polypeptide encoded by the following mRNA: 5'GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGACCAGGUCAA3'


Definitions:

Taste Receptors

Specialized sensory cells located on the tongue that are responsible for detecting different types of tastes, such as sweet, sour, salty, bitter, and umami.

Supertasters

Individuals who have a heightened sense of taste, often due to a greater number of taste buds on their tongue.

Umami

One of the five basic tastes, recognized for its savory flavor, which is attributed to the presence of glutamate and other amino acids.

Gustatory System

The sensory system responsible for the perception of taste and flavor.

Related Questions