GGGCCATTCGAACGTCCGAAAATGCCCCTGAATGAAAATTTTGGCCC

question 30

Multiple Choice

GGGCCATTCGAACGTCCGAAAATGCCCCTGAATGAAAATTTTGGCCC. The primer used for replication in vitro is CCCGGTAAGCTT. Where is the 5' end for the template and primer, respectively?

• A)Left, left
• B)Right, left
• C)Left, right
• D)Right, right

---

Definitions:

Thyroid Hormones

Chemical substances produced by the thyroid gland, such as thyroxine (T4) and triiodothyronine (T3), which regulate metabolism, energy generation, and growth and development.

Zona Fasciculata

The middle layer of the adrenal cortex that synthesizes glucocorticoids, crucial for stress response and metabolism.

Mineralocorticoid

A class of corticosteroids involved in regulating electrolyte and water balance by the kidneys, with aldosterone being a key example.

Adrenal Cortex

The outer layer of the adrenal glands, which produces essential hormones such as cortisol, aldosterone, and androgens.