The Restriction Enzyme SmaI Cuts DNA Between the Last C

question 28

Multiple Choice

The restriction enzyme SmaI cuts DNA between the last C and the first G in the sequence CCCGGG.How many fragments of DNA would be produced if the following sequence were treated with SmaI? AGTTTCGAGAGCGGATGCCCGGGCCACGGGGATTATACGCAGAGTCCAC
TCAAAGCTCTCGCCTACGGGCCCGGTGCCCCTAATATGCGTCTCAGGTG

• A) One; SmaI does not cut this piece of DNA.
• B) Two; SmaI cuts this piece of DNA once.
• C) Two; SmaI cuts this piece of DNA twice.
• D) Four; SmaI cuts this piece of DNA four times.

---

Definitions:

Primary Care

The day-to-day healthcare given by a health care provider, typically the first point of consultation for all patients within the health care system.

Latent Functions

Are invisible and unintended effects of social structures.

Custodial Service

Services related to the maintenance and cleaning of buildings, facilities, or grounds.

Job Competition

A process where individuals apply for the same position, aiming to secure employment by showcasing their skills and qualifications.