Here Are Noncoding Sequences from Mary and Bob

question 5

Multiple Choice

Here are noncoding sequences from Mary and Bob.Both sequences come from the same region of chromosome 12:
Mary: TTCGTTCCCAGCTAGCTAGCTAGCTAGCTTAACCGGC
Bob: TTCGTTCCCAGCTAGCTTAACCGGC
Which of the following accurately compares Mary and Bob's DNA?

• A) Mary and Bob are most likely fraternal twins.
• B) Mary has five STRs at this site;Bob has two.
• C) Mary has one STR at this site;Bob has none.
• D) The DNA shown must be from the 23rd chromosome,not the 12th.
• E) None of the above.

---

Definitions:

Collective Responsibility

The concept that members of a group or society share responsibility for actions and outcomes attributed to the group as a whole.

Mass Killing

The act of murdering a large number of people, typically in a single event or over a relatively short period of time, often with motive related to terrorism, genocide, or spree killing.

Low in Competence

Refers to individuals or entities that demonstrate inadequate levels of skill, knowledge, or ability in specific areas or overall.

Objectification Prime

Exposure to stimuli or conditions that trigger or enhance the perception of individuals as objects rather than as fully dimensional human beings.