You Have the Following DNA Template and Want to Use

question 46

Multiple Choice

You have the following DNA template and want to use PCR to amplify the double-stranded region that is underlined.What primer should you use?
5' - CCGGATCAATCAATGCCGAATTTCCGTATAGGGCCTAGTAG - 3'
3' - GGCCTAGTTAGTTACGGCTTAAAGGCATATCCCGGATCATC - 5'

• A)5' - AGGGC- 3' and 5' -GATTG- 3'
• B)5' -CAATC- 3' and 5' -GCCCT- 3'
• C)3' -CAATC- 5' and 3' -GCCCT- 5'
• D)3' - AGGGC- 5' and 3' -GATTG- 5'
• E)5' -GTTAG -3' and 5' -ATCCC -3'

Identify and use keyboard shortcuts for navigation and formatting within Word documents.

Comprehend the structure and styles of business letters.

Understand the options for vertical alignment in Word documents.

Grasp the concept and application of signature blocks in business letters.

---

Definitions:

Liabilities

Financial obligations or debts owed by a business to others, including loans, accounts payable, and mortgages.

Total Liabilities

The sum of all financial obligations a company owes to outsiders, including debts, accounts payable, and other liabilities.

Accounting Equation

A fundamental principle in accounting that states assets equal the sum of liabilities and owner's equity (Assets = Liabilities + Equity).

Net Income

The net income of a business following the subtraction of all costs, such as operating expenses and taxes, from its overall revenue.