Examlex
You have the following DNA template and want to use PCR to amplify the double-stranded region that is underlined.What primer should you use?
5' - CCGGATCAATCAATGCCGAATTTCCGTATAGGGCCTAGTAG - 3'
3' - GGCCTAGTTAGTTACGGCTTAAAGGCATATCCCGGATCATC - 5'
Mechanism
A detailed description of the step-by-step process by which a chemical reaction occurs, including the breaking and formation of bonds.
Carboxylic Acid
Organic acids characterized by the presence of at least one carboxyl group (-COOH), widely found in nature.
Derivative
In chemistry, a compound that is derived from a similar compound by a chemical reaction.
Propyl Benzoate
A chemical compound used as a fragrance and flavoring agent, consisting of the propyl ester of benzoic acid.
Q2: Molecular clocks are based primarily on rates
Q6: What are the closest ancestors of humans
Q7: Cyanobacteria,or blue-green algae,are considered the most ancient
Q12: Hormones are released from one cell and
Q26: You analyze two daughter cells of Bacteria
Q29: When a gamete that is lacking a
Q38: What is NOT a criterion for an
Q38: Segmention is a characteristic feature of<br>A)CnidariA.<br>B)Arthropoda.<br>C)Platyhelminthes.<br>D)Rotifera.<br>E)Nematoda.<br>
Q44: The process by which haploid cells are
Q55: Which of the following is NOT related