Below Is a Single Stranded DNA Sequence from an Unwound

question 65

Multiple Choice

Below is a single stranded DNA sequence from an unwound chromosome that is in the process of replication.What would be the sequence of the complementary DNA strand produced during the replication of this strand?
ATTGCGCTTATTCGCGTTAAAGGCCTCTGATG

• A)GCCATATCCGCCTATACCGGGAATTCTCAGCA
• B)CGGTATAGGCGGATATGGCCCTTAAGAGTCGT
• C)ACCTGTGTTAAGTGTACGTAAAGCTAATGGGT
• D)TAAGCGCAATAACGCGAATTTCCGGAGAGTAG
• E)TAACGCGAATAAGCGCAATTTCCGGAGACTAC

---

Definitions:

Factory Overhead Rate

The method of allocating indirect costs to produced goods, usually calculated by dividing total factory overhead costs by a base such as direct labor hours or machine hours.

Product Costing

The method used to determine the expenses associated with producing a product, considering factors like raw materials, labor, and overhead costs.

Factory Overhead

Indirect costs related to manufacturing, including costs associated with operating the factory like utilities and salaries, but excluding direct materials and direct labor.

Indirect Materials

Materials used in the production process that cannot be directly linked to specific products or jobs, such as lubricants for machinery.