Examlex
A silent mutation occurs when a nucleotide mutation results in the identical amino acid in place upon completion of translation.If the original sequence is as follows,which example below represents a silent mutation?
GUACAAGCAUGAAGUUUGGUAAGCG
Q19: A typical eukaryotic cell contains up to
Q23: The precursors of 5S rRNA, the tRNAs,
Q30: Which of the following require a cyclic
Q48: The resource income earned by those who
Q70: A university must decide if it wants
Q77: When deciding on which new products to
Q79: Refer to Table 2-7. What is Tammi's
Q106: What is a marginal cost?
Q131: Consider the following statements: a. Consumers buy
Q177: Refer to Table 2-8. What is Scotland's