Examlex

Solved

A Silent Mutation Occurs When a Nucleotide Mutation Results in the Identical

question 44

Multiple Choice

A silent mutation occurs when a nucleotide mutation results in the identical amino acid in place upon completion of translation.If the original sequence is as follows,which example below represents a silent mutation?
GUACAAGCAUGAAGUUUGGUAAGCG


Definitions:

Firm's Product Line

The range of products or services offered by a company, encompassing various goods within the same category.

Customer Relationship Marketing

A marketing strategy focused on building and maintaining long-term, personal relationships with customers.

Intimate Friendship

An intimate and personal bond marked by strong love, confidence, and reciprocal comprehension.

Business Friendship

A professional relationship that incorporates mutual respect, trust, and personal interest, enhancing collaboration.

Related Questions