Examlex
A silent mutation occurs when a nucleotide mutation results in the identical amino acid in place upon completion of translation.If the original sequence is as follows,which example below represents a silent mutation?
GUACAAGCAUGAAGUUUGGUAAGCG
Firm's Product Line
The range of products or services offered by a company, encompassing various goods within the same category.
Customer Relationship Marketing
A marketing strategy focused on building and maintaining long-term, personal relationships with customers.
Intimate Friendship
An intimate and personal bond marked by strong love, confidence, and reciprocal comprehension.
Business Friendship
A professional relationship that incorporates mutual respect, trust, and personal interest, enhancing collaboration.
Q2: The DNA sequence shown below is copied
Q5: The light reactions of photosynthesis occur in
Q22: The triplet code allows many amino acids
Q29: The activity of the _ enzyme glucokinase
Q37: Which mechanism is the method by which
Q42: What enzymes would be used to repair
Q54: The ratio of sales to invested assets
Q77: Decisions to install new equipment,replace old equipment,and
Q78: In evaluating the profit center manager,the income
Q131: The objective of transfer pricing is to