Examlex

Solved

A Silent Mutation Occurs When a Nucleotide Mutation Results in the Identical

question 44

Multiple Choice

A silent mutation occurs when a nucleotide mutation results in the identical amino acid in place upon completion of translation.If the original sequence is as follows,which example below represents a silent mutation?
GUACAAGCAUGAAGUUUGGUAAGCG


Definitions:

Brain's Reward Pathway

A neural pathway in the brain that releases dopamine in response to experiences perceived as rewarding, motivating repetition of those behaviors.

Tolerance

The need to take increasing amounts of a drug to get the same effect.

Marijuana

A psychoactive drug from the Cannabis plant used for medical or recreational purposes.

Dopamine Dependence

A condition where an individual's normal neurobiological reward system becomes excessively reliant on activities or substances that significantly increase dopamine levels.

Related Questions