A DNA Sequence Has Been Cut into the Following Four

question 156

Multiple Choice

A DNA sequence has been cut into the following four overlapping sequence fragments:
(1) AGGGGCCTATAGCATACGTACA
(2) CGTACATCTGAGGGTACGATCATGGC
(3) CATGGCTAGCAAACGCGATCCCAAG
(4) AGGCTAGTTACGATATAGGGGCC
What is the correct order of these fragments?

• A) 1, 2, 3, 4
• B) 1, 3, 2, 4
• C) 2, 3, 1, 4
• D) 4, 1, 2, 3
• E) 4, 1, 3, 2

---

Definitions:

Debt Investments-AFS

Available-for-sale debt investments represent debt securities that a company intends to hold for a period of time but may sell before maturity for capital management reasons.

Loss on Sale

The financial loss realized when the selling price of an asset is less than its carrying value on the balance sheet.

Available-For-Sale Securities

Debt or equity securities not classified as held-to-maturity or trading securities, and are purchased with the intention of selling before they mature.

Controlling Influence

The power to govern the financial and operating policies of an entity so as to obtain benefits from its activities, often through ownership or agreement.